| Primary Identifier | MGI:6281341 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | E130308A19Rik |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTATCCTGTGTGGACAGT and GCAGAATTCTTAGGTACGCG, which resulted in a 1432 bp deletion beginning at Chromosome 4 position 59,689,958 bp and ending after 59,691,389 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000339543 (exon 2) and 237 bp of flanking intronic sequence including the translation start and is predicted to result in a null allele. |
