| Primary Identifier | MGI:6294772 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Abca8a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGAGTCTTTCCTCTAAGT and GCTTACCCTATCACTACGTA, which resulted in a 1110 bp deletion beginning at Chromosome 11 position 110,071,149 bp and ending after 110,072,258 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000342464 and ENSMUSE00001068496 (exons 11 and 12) and 940 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 478 and early truncation 5 amino acids later. |