| Primary Identifier | MGI:6306480 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pla2g4d |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGGACCTTGGGAACAAGT and GATTCTATACATCCTTTCCA, which resulted in a 276 bp deletion beginning at Chromosome 2 position 120,283,707 bp and ending after 120,283,982 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000598028 (exon 3) and 139 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 48. |