| Primary Identifier | MGI:6273493 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Abca2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCCCCTTCCAACAGAGACCG and TCTAACCCTAAAGCTCCCCT, which resulted in a 2972 bp deletion beginning at Chromosome 2 position 25,432,845 bp and ending after 25,435,816 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000240810-ENSMUSE00000240762 (exons 3 through 9) and 1710 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 2 amino acids later. |