| Primary Identifier | MGI:6273498 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Abcc8 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGGCACATATGAGACGCA and CTGCAGGCCGGTCCTAAGCA, which resulted in a 406 bp deletion beginning at Chromosome 7 position 46,178,322 bp and ending after 46,178,727 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001040856 (exon 2) and 264 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 50. |
