| Primary Identifier | MGI:6306465 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pus7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTCCTGTCCAGGATCATT and GCGTTGGTTGATATGCGCTA, which resulted in a 364 bp deletion beginning at Chromosome 5 position 23,775,824 bp and ending after 23,776,187 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000487336 (exon 3) and 279 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 9 amino acids later. |