|  Help  |  About  |  Contact Us

Allele : Eif4b<em1(IMPC)J> eukaryotic translation initiation factor 4B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6306475 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Eif4b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATAGTAGTGACTGGTCTG and GTCTTTTTGTGTCAAACTGT, which resulted in a 414 bp deletion beginning at Chromosome 15 position 102,083,956 bp and ending after 102,084,369 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000454881 (exon 3) and 205 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 24 amino acids later. There is a single bp (G) insertion 13 bp after the deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele