| Primary Identifier | MGI:6278287 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dusp29 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTCTGATCCACTGGGGCA and CGTAAGGTGAATGATCCAAA, which resulted in a 703 bp deletion beginning at Chromosome 4 position 21,686,361 bp and ending after 21,687,063 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000563941 (exon 3) and 482 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid residue 66. |