| Primary Identifier | MGI:6273658 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Abhd4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCAAAATGTCTGTGCTCTC and TGATCGCTAGGGAAGCCATG, which resulted in a 3008 bp deletion beginning at Chromosome 14 position 54,262,600 bp and ending after 54,265,607 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000324218, ENSMUSE00001373598, ENSMUSE00000324196 (exons 3-5) and 2368 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 8 amino acids later. |
