| Primary Identifier | MGI:6273660 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nap1l5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGTTATCAGAAAAGAATA and CGAGCCGCGAAGCGGCCGCG, which resulted in a 2165 bp deletion beginning at Chromosome 6 position 58,904,976 bp and ending after 58,907,140 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000459071 (exon 1) and 321 bp of flanking intronic sequence including the Kozak sequence and start site and is predicted to generate a null allele. |
