| Primary Identifier | MGI:6273815 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Atp8a2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTATAAAACAAACGTGGGA and ACTGCATGTCCTTTGTAGGA, which resulted in a 365 bp deletion beginning at Chromosome 14 position 60,046,495 bp and ending after 60,046,859 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000418148 (exon 2) and 265 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 20 amino acids later. |
