| Primary Identifier | MGI:6294897 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cep78 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTATAACCATTGTCTAGCTT and GGCATAGCTTGAAGACTGCG, which resulted in a 297 bp deletion beginning at Chromosome 19 position 15,980,964 bp and ending after 15,981,260 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000418400 (exon 4) and 193 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 172 and early truncation 6 amino acids later. There is a single (A) bp insertion at the deletion site. |
