| Primary Identifier | MGI:6294909 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rsu1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATGCTGTGGGCAAGCAAG and AATGCATGTGGACAGCACTG, which resulted in a 481 bp deletion beginning at Chromosome 2 position 13,224,231 bp and ending after 13,224,711 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001241282 (exon 4) and 360 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 54. |
