| Primary Identifier | MGI:6295415 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Plb1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCTTGCTCACTTTATGCCG and GGCATGCTACGGAGACATAA, which resulted in an 860 bp deletion beginning at Chromosome 5 position 32,269,682 bp and ending after 32,270,541 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001292559 and ENSMUSE00001254053 (exons 5 and 6) and 809 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 13 amino acids later. |
