| Primary Identifier | MGI:6283589 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rrbp1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTCCATCAGTCACAGTCAG and AGGCGGATGGAGAAGTACAG, which resulted in a 2404 bp deletion beginning at Chromosome 2 position 143,988,095 bp and ending after 143,990,498 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000521125 (exon 2) and 285 bp of flanking intronic sequence including the splice acceptor and translation start and is predicted to result in a null allele. There is an 11 bp insertion at the deletion site (TTAGTGCTTAG). |
