|  Help  |  About  |  Contact Us

Allele : Rrbp1<em1(IMPC)J> ribosome binding protein 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6283589 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rrbp1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTCCATCAGTCACAGTCAG and AGGCGGATGGAGAAGTACAG, which resulted in a 2404 bp deletion beginning at Chromosome 2 position 143,988,095 bp and ending after 143,990,498 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000521125 (exon 2) and 285 bp of flanking intronic sequence including the splice acceptor and translation start and is predicted to result in a null allele. There is an 11 bp insertion at the deletion site (TTAGTGCTTAG).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele