| Primary Identifier | MGI:6283592 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Vstm4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTAAAGTAAAATAAGACGA and GCAGGACATGACTAATACGG, which resulted in a 900 bp deletion beginning at Chromosome 14 position 32,863,282 bp and ending after 32,864,181 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000367509 (exon 2) and 501 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a loss of 133 amino acid sequence but remain in frame. |
