Primary Identifier | MGI:6307004 | Allele Type | Endonuclease-mediated |
Attribute String | Null/knockout | Gene | Gtf2ird2 |
Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
Is Recombinase | false | Is Wild Type | false |
Project Collection | IMPC |
molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTGCCCTAGATGAAGCTGG and CTAAACAGGCTGTCAGGCTC, which resulted in a 257 bp deletion beginning at Chromosome 5 position 134,196,365 bp and ending after 134,196,621 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001266451 (exon 5) and 73 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 117 and early truncation 2 amino acids later. |