| Primary Identifier | MGI:6283505 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sft2d2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATATCTACCGCGTTTGAGGG and TGTGTTAGAGATGGTCTGAA, which resulted in a 521 bp deletion beginning at Chromosome 1 position 165,187,898 bp and ending after 165,188,418 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000229846 and ENSMUSE00000229842 (exons 2 and 3) and 348 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 15 amino acids later. |