| Primary Identifier | MGI:6307027 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ubxn1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCAAAACAGTAATATAAAG and AGACTAGTGTGCTCCCTCTG, which resulted in a 744 bp deletion beginning at Chromosome 19 position 8,873,374 bp and ending after 8,874,117 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000621647 and ENSMUSE00000621646 (exons 6 and 7) and 482 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 73 and early truncation 65 amino acids later. |
