| Primary Identifier | MGI:6285481 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Col6a3 |
| Transmission | Germline | Strain of Origin | (C57BL/6 x 129S4/SvJae)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A premature stop codon was inserted into exon 36 generating a C-terminal truncation. CAACTGTCCGCGG was deleted and replaced by CCCACAAAGAGAGAGAGTCA via CRISPR/Cas9 technology, yielding a frame-shift and premature stop codon in exon 36. In the predicted protein product, the 15 amino acid sequence NCPRGARVAVVTYNN is replaced by PQRERVRCPRGCGHL followed by the stop codon, resulting in severe disruption of the C1 domain (out of 180 amino acids, 36 intact, 15 altered, and 129 missing) and complete absence of the C2-C5 domains. |
