| Primary Identifier | MGI:6284316 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ak3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAACAAGCCTATTAGCACG and TGAGCCCAAGGAATGACACC, which resulted in a 552 bp deletion beginning at Chromosome 19 position 29,027,034 bp and ending after 29,027,585 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000144943 (exon 3) and 379 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 91 and early truncation 1 amino acid later. |
