| Primary Identifier | MGI:6284829 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ablim2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAGTCCTAGCACCAAGGAG and CCTGGGAGCAGGCAACCATA, which resulted in a 552 bp deletion beginning at Chromosome 5 position 35,841,047 bp and ending after 35,841,598 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000185461 (exon 11) and 431 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 350 and early truncation 37 amino acids later. |
