| Primary Identifier | MGI:6314751 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tuba1c |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, AAGATAGGATCACTTTTCAG and TATCATGGCAGCACTCATAG, which resulted in a 4195 bp deletion beginning at Chromosome 15 position 99,034,012 bp and ending after 99,038,208 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000972932, ENSMUSE00001011522, and ENSMUSE00000501603 (exons 2-4) and 2747 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to generate a null allele, by a change of amino acid after residue 1 and truncation 6 amino acids later, by read through. |
