| Primary Identifier | MGI:6302762 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Syne2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATTCCCTAAAGATCCCACT and CTGCTCACAGCAATAAACAA, which resulted in a 640 bp deletion beginning at Chromosome 12 position 75,887,919 bp and ending after 75,888,558 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001247793 (exon 7) and 452 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 136 and early truncation 1 amino acid later. |
