|  Help  |  About  |  Contact Us

Allele : Kbtbd8<em1(IMPC)Tcp> kelch repeat and BTB (POZ) domain containing 8; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6302753 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Kbtbd8
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1301 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGTGGTCCTTCACCTATCA and TCCATCACCTGTAGTTCCCC targeting the 5' side and GAGAAAATCTACGTTTTACA and CATCAAAGGGTTGCATGCCA targeting the 3' side of a critical region. This resulted in a 1446-bp del Chr6: 95121396-95122841 with 24-bp insert at deletion junction (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele