| Primary Identifier | MGI:6302806 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ssc4d |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGACGTTGTAGATGCTAACG and CCTGTGCTGCTAGACAACGT, which resulted in a 4952 bp deletion beginning at Chromosome 5 position 135,962,986 bp and ending after 135,967,937 bp (GRCm38/mm10). This mutation deletes the last 200 bp of exon 4 and all intervening sequence through the first 249 bp of exon 9 (ENSMUSE00000686859 - ENSMUSE00000686851) including the splice acceptors and donors. There is a single bp (T) insertion at the deletion site. This mutation is predicted to cause a change of amino acid sequence after residue 103 and early truncation 62 amino acids later. |
