| Primary Identifier | MGI:6303837 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cers5 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The CRISPR/Cas9 system and sgRNA 5'-TGTTACTAAGGTAAGTGAGC-3' was used to generate the mice. The CRISPR/Cas9 system generated a 20-base pair deletion TCATCCGGCTCACTTACCTT at g.21297_21278 (NC_000081.6). The mutation is predicted to destroy the exon 2 donor splice site, resulting in the use of an adjacent cryptic site. The resulting transcript would have a 47-bp insertion causing a frame-shifted protein product beginning after amino acid 100 of the protein and premature termination after the inclusion of seven aberrant amino acids. |
