| Primary Identifier | MGI:6336122 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Letmd1 |
| Strain of Origin | C57BL/6NTac | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 RNA and the guide sequence CGGATCGTACCATCGTTTCTTGG, which resulted in a Indel. |
