| Primary Identifier | MGI:6330722 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Adgrg4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAACTTCTTCCCAAACTAC and CCAACTGCCAAAGAGTCTAC, which resulted in a 5813 bp deletion beginning at Chromosome X position 56,913,220 bp and ending after 56,919,032 bp (GRCm38/mm10). This mutation deletes 5813 bp of ENSMUSE00000386381 (exon 3) and is predicted to cause a change of amino acid sequence after residue 254 and early truncation 9 amino acids later. There is a 1 bp insertion (G) at the deletion site. |