|  Help  |  About  |  Contact Us

Allele : Adgrg4<em1(IMPC)J> adhesion G protein-coupled receptor G4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6330722 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Adgrg4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAACTTCTTCCCAAACTAC and CCAACTGCCAAAGAGTCTAC, which resulted in a 5813 bp deletion beginning at Chromosome X position 56,913,220 bp and ending after 56,919,032 bp (GRCm38/mm10). This mutation deletes 5813 bp of ENSMUSE00000386381 (exon 3) and is predicted to cause a change of amino acid sequence after residue 254 and early truncation 9 amino acids later. There is a 1 bp insertion (G) at the deletion site.
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele