| Primary Identifier | MGI:6336139 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Thsd7b |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 Protein and 2 guide sequences CCTGGTTTTCAGCACTAAGCAAC, CCTCTATTTTATCTATGCTGGGC, which resulted in a Exon Deletion. |