| Primary Identifier | MGI:6314217 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Naa35 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATAATTGAAAGCATCACTG and TAGGATACTTTTCACGAAGA, which resulted in a 306 bp deletion beginning at Chromosome 13 position 59,595,218 bp and ending after 59,595,523 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000118943 (exon 3) and 272 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 12 amino acids later. There is a 3 bp intronic deletion (TCT) 41 bp before the larger deletion site. |