|  Help  |  About  |  Contact Us

Allele : Ammecr1l<em1(IMPC)Kmpc> AMME chromosomal region gene 1-like; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center

Primary Identifier  MGI:6336110 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ammecr1l
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting and 2 guide sequences CCCTCTAGTGCACTTAAGGACAG, AGGCATTCTTTGCTATGAGCCGG, which resulted in a Exon Deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele