| Primary Identifier | MGI:6305181 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mettl18 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCCTGTCTACAAATCTTG and CACTCCATAAACATGTTCCG, which resulted in a 1789 bp deletion beginning at Chromosome 1 position 163,995,732 bp and ending after 163,997,520 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000688041 (exon 2) and 459 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. There is a 14 bp insertion at the deletion site (GTAGTATGTAGAGTA). |
