|  Help  |  About  |  Contact Us

Allele : Mettl18<em1(IMPC)J> methyltransferase like 18; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6305181 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mettl18
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCCTGTCTACAAATCTTG and CACTCCATAAACATGTTCCG, which resulted in a 1789 bp deletion beginning at Chromosome 1 position 163,995,732 bp and ending after 163,997,520 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000688041 (exon 2) and 459 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a null allele. There is a 14 bp insertion at the deletion site (GTAGTATGTAGAGTA).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele