| Primary Identifier | MGI:6341870 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmem47 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 RNA and the guide sequence CCGCGGACCACCAGTACTACCTG, which resulted in a Indel. |