| Primary Identifier | MGI:6316161 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Alg6 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0837 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with 4 guide RNAs with spacer sequences of GGACATTTGGAGTATCCAGA and GTGCTCTTGCCGCTTTGAGT targeting the 5' side GGTCTTATTCTTATCGACTA and CCTAGATCATAATATGTAAC targeting the 3' side of exons ENSMUSE00001275430 and ENSMUSE00001257593 resulting in a 1431-bp deletion Chr4: 99740974 to 99742404; 20-bp deletion Chr4:99740914 to 99740932_insCCA; Chr4:99742454_insA (GRCm38). |
