| Primary Identifier | MGI:6316165 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Bdp1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR880 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNA(s) with spacer sequences of GATACATTGGAGAGGTGAAG and GCCAGGCATAATGAAATACA targeting the 5' side and TAAAATGGAACCTGCCACGT and CTGCCAACTATTCACTTAAA targeting the 3' side resulting in a 1,610-bp deletion Chr13:100092103 to 100093712 &2-bp deletion Chr13:100091998 to 100091997_delTT (GRCm38). |
