| Primary Identifier | MGI:6316166 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc9b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele, from project TCPR0366, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences AAGCCGAGTCCACAATGCGC and TGCGCAAGGCAACTATCCTA. This resulted in a 48 bp deletion from Chr2:118761689 to 118761736 (GRCm38), and an insertion of GCTCGGCATCTTTTTCCTC. This mutation is predicted to cause a frameshift with amino acid changes after residue 56 and early truncation 57 amino acids later (p.T57Sfs*59). |
