| Primary Identifier | MGI:6316168 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cdk12 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0588 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CAATGGTTATCATAGAATTC and GTAAGAAGCCAATTGTGTAA targeting the 5' side and GCCTTATATTTCAGAGGTTC and TGCACTACACTTTATCAAAA targeting the 3' side of exon ENSMUSE00000577506 resulting in a 823 bp deletion of Chr11 from 98220973 to 98221795 (GRCm38). |