|  Help  |  About  |  Contact Us

Allele : Colec10<em1(IMPC)Tcp> collectin sub-family member 10; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6316172 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Colec10
Strain of Origin  CD-1 Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0371 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences of GCAAATTCAAGGAACAATAT targeting the 5' side and GCTTTTGCTCAAATGCCATA targeting the 3' side of exon ENSMUSE00000352964 resulting in an 1108-bp deletion of Chr15 from 54461600 to 54462707 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele