|  Help  |  About  |  Contact Us

Allele : Cyp2d22<em2(IMPC)Tcp> cytochrome P450, family 2, subfamily d, polypeptide 22; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316173 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cyp2d22
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0614 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ACACTAGCAAGGTCATGATG and GAATGCATTACGGGCAAGCC targeting the 5' side and GGCTTTGGACCACGCTCTCA and CTCTGGGACCTAATTGAGGT targeting the 3' side of exon ENSMUSE00000250238 resulting in a 331-bp deletion of Chr15 from 82374301 to 82374631, and a 1-bp deletion of Chr15 at 82374319 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele