| Primary Identifier | MGI:6341925 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dtx4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCTCCAAACATGGGGTTCAGGTA, GCCCTATGTTTCACTAATGATGG, which resulted in a Exon Deletion. |