| Primary Identifier | MGI:6316197 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mrgprb2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0501 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AGGTGCTTAGATTCTTGATT and CATTTAGTCCCATCCCAACC targeting the 5' side and TTAGGCACCGAAGGTTCAGG and GAGTCTTCCGCCTGAACCTT targeting the 3' side of exon ENSMUSE00000388025 (exon 2) resulting in a 740-bp deletion of Chr7 from 48552089 to 48552828 (GRCm38). |