| Primary Identifier | MGI:6316209 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnf135 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0621 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTCTGACTTGTGTACTCAGG and TTGGAACAGGGCTCACACGT targeting the 5' side and GGCCATTCCCACCCAATCAG and TGATCCCTAATCCTAGTTTA targeting the 3' side of exon ENSMUSE00000108337 resulting in a 2,115-bp deletion of Chr11 from 80192852 to 80194966_insAAGGCA & a 390-bp deletion of Chr11 from 80195037 to 80195426 (GRCm38). |
