|  Help  |  About  |  Contact Us

Allele : Gm4922<em2(IMPC)Tcp> predicted gene 4922; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316182 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gm4922
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0417 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTGAGCTCGGTCTTGGTTTG and CTTCAGGACGGTGTACTGCC targeting the 5' side and CAGCTCAGTGTCCTAATCAC and ATGTCCGTTTGGCAGAATAG targeting the 3' side of exon ENSMUSE00000403934 resulting in a 1,705-bp deletion of Chr10 from 18783188 to 18784892 deleting majority of ENSMUSE00000403934 including splice donor (single exon ORF) and a 2-bp deletion Chr10 from 18783160 to 18783161 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele