| Primary Identifier | MGI:6316159 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Acad10 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0809 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with 4 single guide RNAs having spacer sequences of CCCGCCATTCCCACAGTATG and TCCTATAACGGGAAGCGTTC targeting the 5' side and ACCCACTCCACCGGTAGGGA and GTGCTCTTACGGATCTGTAA targeting the 3' side of exon ENSMUSE00001224898 and ENSMUSE00001296632 resulting in a 1,529-bp deletion Chr5:121646600 to 121648128 (GRCm38). |