|  Help  |  About  |  Contact Us

Allele : Acad10<em2(IMPC)Tcp> acyl-Coenzyme A dehydrogenase family, member 10; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316159 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Acad10
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0809 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with 4 single guide RNAs having spacer sequences of CCCGCCATTCCCACAGTATG and TCCTATAACGGGAAGCGTTC targeting the 5' side and ACCCACTCCACCGGTAGGGA and GTGCTCTTACGGATCTGTAA targeting the 3' side of exon ENSMUSE00001224898 and ENSMUSE00001296632 resulting in a 1,529-bp deletion Chr5:121646600 to 121648128 (GRCm38).
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele