| Primary Identifier | MGI:6316309 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nek2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPC309 was generated at The Centre for Phenogenomics by injecting Cas9D10A mRNA and guide RNAs with spacer sequences GGTCCCGGTGAAGCACAGTG and CAGCAAACACAATGTCAAGC, which resulted in an 8-bp deletion CTTCACCG in Chromosome 1 positive strand 191822588 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. c.412_419delCTTCACCG; p.(L138Gfs*22) |
