| Primary Identifier | MGI:6316614 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Spag6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGGTTAGTTACTAACCAG and AGGGAATCTGAAGGAGACGG, which resulted in a 533 bp deletion beginning at Chromosome 2 position 18,715,493 bp and ending after 18,716,025 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000605260 (exon 4) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 96 and early truncation 14 amino acids later. |