| Primary Identifier | MGI:6316340 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Efhb |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGTGATGTCATTGTCAAC and ATACATTCCACTCCTTAACC, which resulted in a 3470 bp deletion beginning at Chromosome 17 position 53,449,206 bp and ending after 53,452,675 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000136456 through ENSMUSE00000136452 (exon 2-4) and 3082 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 283 and early truncation 7 amino acids later. |
