|  Help  |  About  |  Contact Us

Allele : Ipo4<em1(IMPC)J> importin 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6342428 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ipo4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAATGGTTCTGGTTTGCCG and ATAAGACCACCGACAGCTGG, which resulted in a 1170 bp deletion beginning at Chromosome 14 position 55,632,815 bp and ending after 55,634,584 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001294570 through ENSMUSE00001229180 (exons 5-10) and 1043 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 93 and early truncation 17 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele