| Primary Identifier | MGI:6342466 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tstd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGGAAGTCGGCATTCAGAT and AGGGGACTGCTTTAATTGGG, which resulted in a 774 bp deletion beginning at Chromosome 1 position 171,419,685 bp and ending after 171,420,458 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000906189 and ENSMUSE00000879015 (exons 3 and 4) and 449 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 62 and early truncation 30 amino acids later. |